Journal: Pathology and Oncology Research

Article Title: Pathological Changes and Expression of JAK-STAT Signaling Pathway Hallmark Proteins in Rat Retinas at Different Time Points After Retinal Ischemia Reperfusion Injury

doi: 10.3389/pore.2022.1610385

Figure Lengend Snippet: Immunohistochemistry staining showing protein expression and localization of JAK2, STAT3, p-JAK2, p-STAT3, Bcl-2, and Bax in control, RIRI 0, 6, 24, 72, and 144 h groups. (A) Protein expression of JAK2, STAT3, p-JAK2, p-STAT3, Bcl-2, and Bax in six groups. Scale bar = 50 μm. (B–G) Analysis of JAK2 (B) , STAT3 (C) , p-JAK2 (D) , p-STAT3 (E) , Bcl-2 (F) , and Bax (G) in six groups. N = 5 sections for measuring per group. Compared with control group; ns, no significance, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Primary antibodies were as follows: JAK2 (bs-23003r, Bioss), STAT3 (60199-1-lg, Proteintech), p-JAK2 (ab32101, Abcam), p-STAT3 (sc-8059, Santa), Bcl-2 (ab194583, Abcam), and Bax (A19684, ABclonal).

Techniques: Immunohistochemistry, Staining, Expressing

Journal: Pathology and Oncology Research

Article Title: Pathological Changes and Expression of JAK-STAT Signaling Pathway Hallmark Proteins in Rat Retinas at Different Time Points After Retinal Ischemia Reperfusion Injury

doi: 10.3389/pore.2022.1610385

Figure Lengend Snippet: The hallmarker protein expression of JAK-STAT signaling pathway in control, RIRI 0, 6, 24, 72, and 144 h groups. (A) Protein expression of JAK2, p-JAK2, STAT3, and p-STAT3 in six time points groups. (B–E) Analysis of JAK2 (B) , p-JAK2 (C) , STAT3 (D) , and p-STAT3 (E) in six groups. N = 3–6 repeats per group. Compared with control group, ns, no significance, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: Primary antibodies were as follows: JAK2 (bs-23003r, Bioss), STAT3 (60199-1-lg, Proteintech), p-JAK2 (ab32101, Abcam), p-STAT3 (sc-8059, Santa), Bcl-2 (ab194583, Abcam), and Bax (A19684, ABclonal).

Techniques: Expressing

Journal: medRxiv

Article Title: Polymorphism in IFNAR contributes to glucocorticoid response and outcome in ARDS and COVID-19

doi: 10.1101/2022.03.10.22272123

Figure Lengend Snippet: (A ) STAT1 expression in the lung after 4-day culture in the presence of IFN beta with or without hydrocortisone (HC). ( B) pSTAT1 expression in the same specimens as in A. ( C) Example photomicrographs showing higher STAT2 expression in a TT patient than in a CT patient and the effect of HC on its nuclear translocation. Most STAT2 remains in the cytoplasm of the CT patients, whereas nuclear expression is prominent in the TT patient. Indicated insets are shown in the bottom row. Arrows. ( D ) Combined results of all patients noting that two CT samples are excluded in the data as the patients were already under glucocorticoid treatment at the time of sample acquisition. Ns, not significant; *P<0.05; **P<0.01; and ***P<0.001

Article Snippet: The first stage antibodies were anti-alpha chain of the IFN alpha/beta receptor (St John’s Laboratory STJ112765) that was used 1:2000 and 1:5000 and anti-Stat1 (1:400, 9175S), anti-pStat1(1:100, 9167S) and anti-Stat2 (1:200, 72604S) all from Cell Signalling.

Techniques: Expressing, Translocation Assay

Journal: Experimental and Therapeutic Medicine

Article Title: Crocin promotes apoptosis of human skin cancer cells by inhibiting the JAK/STAT pathway

doi: 10.3892/etm.2018.6865

Figure Lengend Snippet: Crocin inhibits the JAK/STAT signaling pathway and promotes apoptosis of skin cancer cells. (A) A431 and SCL-1 cells were cultured with two media each contains 0.4 and 0.8 mM crocin, for the purpose of detecting the protein expression of Jak2 and Stat3 through western blot analysis. (B) A431 and SCL-1 cells were cultured with a medium containing 0.8 mM crocin, or overexpressed JAK2, for the purpose of testing the cell viability utilizing the MTT assay. *P<0.05; **P<0.01; ***P<0.001.

Article Snippet: Primary mouse monoclonal B-cell lymphoma-2 (Bcl-2) antibody (cat. no. ab59348; dilution, 1:500); rabbit polyclonal Caspase-3 antibody (cat. no. ab13847; dilution, 1:500); rabbit monoclonal Bid antibody (cat. no. ab32060; dilution, 1:500); rabbit monoclonal JAK2 antibody (cat. no. ab108596; dilution, 1:500); mouse monoclonal STAT3 antibody (cat. no. ab119352; dilution, 1:500); rabbit polyclonal GAPDH antibody (cat. no. ab37168; dilution, 1:500) and secondary goat anti-rabbit (HRP) IgG antibody (cat. no. ab6721; dilution, 1:2,000) were all purchased from Abcam (Cambridge, MA, USA).

Techniques: Cell Culture, Expressing, Western Blot, MTT Assay

Journal: International Journal of Immunopathology and Pharmacology

Article Title: Protective effect of baicalin against arsenic trioxide-induced acute hepatic injury in mice through JAK2/STAT3 signaling pathway

doi: 10.1177/20587384211073397

Figure Lengend Snippet: Effects of BA on JAK2/STAT3 signaling pathway in ATO-induced mice. (a) Western blot analysis was used to assess the hepatic protein expression levels of JAK2, p-JAK2, STAT3, and p-STAT3. (b) The relative expression level of p-JAK2. (c) The relative expression level of p-STAT3. The results are rendered by the mean ± SEM ( n = 3). ## p < 0.01 compared with the CON group, * p < 0.05 and ** p < 0.01 compared with the ATO group. Abbreviations: CON: control group; ATO: arsenic trioxide-treated group; L-BA: low-dose baicalin group; H-BA: high-dose baicalin group; BA: baicalin alone group; SEM: standard error of the mean.

Article Snippet: Antibodies: anti-Bcl-2 associated X protein (BAX) (Servicebio, Wuhan; GB11690), anti-B-cell lymphoma 2 (Bcl-2) (Cloud-clonal, Wuhan; PAA778Mu01), anti-caspase-3 (Proteintech Group, Wuhan; 66,470-2-lg), anti-NF-κB (Servicebio, Wuhan; GB11142), anti-JAK2 (Servicebio, Wuhan; GB11325), anti-p-JAK2 (BIOSS, Beijing; BS-2485R), anti-STAT3 (Servicebio, Wuhan; GB11176), anti-p- STAT3 (Ruiying Biological, Jiangsu; RLP0250), and anti-β-actin (Servicebio, Wuhan; GB12001).

Techniques: Western Blot, Expressing

Journal: Biomolecules

Article Title: E6 Oncoproteins from High-Risk Human Papillomavirus Induce Mitochondrial Metabolism in a Head and Neck Squamous Cell Carcinoma Model

doi: 10.3390/biom9080351

Figure Lengend Snippet: 16E6 and 18E6 oncoproteins increase mitochondrial metabolism in FaDu cells. Human papillomavirus (HPV) E6 oncoproteins increase the protein levels of the subunits of mitochondrial complexes I to IV: Complex I subunit CI-NDUFB8, Complex II subunit CII-SDHB, Complex III-Core protein 2 (CIII-UQCRC2), Complex IV subunit I (CIV-MTCO1), and ATP synthase alpha subunit (CIV-ATP5A), as well as the voltage dependence anion channel (VDAC). ( A ) Representative immunoblot and densitometric analysis of VDAC; and ( B ) Representative immunoblot and densitometric analysis of mitochondrial complexes subunits I-IV and ATP synthase subunit in FaDu transfected cells. α-actinin was used as a loading control. Data are expressed as the mean ± SD. Tukey’s test * p < 0.05 and ** p < 0.005 vs. p3X control, n = 3.

Article Snippet: Primary antibodies were prepared in TBS/T buffer in the following concentrations: anti-glyceraldehyde 3 phosphate dehydrogenase (GAPDH) 1:1000 (SC-32233, Santa Cruz Biotechnology Inc., Dallas, TX, USA); anti-actinin 1:1000 (SC-17829, Santa Cruz Biotechnologies); anti-SOD2 1:1000 (#13141, Cell Signaling); anti-SOD1 1:1000 (#4266, Cell Signaling); anti-Akt 1:2000 (#2920, Cell Signaling); anti-phospho-Nrf2 Ser40 (pNrf2) 1:500 (ab76026, Abcam, Cambridge, UK); anti-phopho-Akt (Ser473) 1:2000 (#4060, Cell Signaling); anti-FoxO3a 1:1000 (#99199, Cell Signaling); Glutamate-cysteine ligase modifier subunit (GCLM) 1:500 (ab55436, Abcam); anti-catalase 1:500 (#12980, Cell Signaling); anti-gamma H2A histone family member X (γH2AX) 1:1000 (clone JBW301, Merck Millipore Upstade, Burlington, MA, USA); anti-FLAG M2 1:2000 (F1804, Sigma-Aldrich); anti-voltage dependent anion channel (VDAC) 1:1000 (sc-390996, Santa Cruz Biotechnologies); and, anti-total OXPHOS cocktail 1:1000 (ab110413, Abcam), which targets the following proteins: subunit of Complex I (NDUFB8-20 kD), subunit of Complex II (SDHB-30kD), subunit Complex III-Core protein 2 (UQCRC2-48 kD), subunit Complex IV subunit I (MTCO1-40 kD), and subunit Complex V alpha (ATP5A-55 kD).

Techniques: Western Blot, Transfection, Control

Journal: Biomolecules

Article Title: E6 Oncoproteins from High-Risk Human Papillomavirus Induce Mitochondrial Metabolism in a Head and Neck Squamous Cell Carcinoma Model

doi: 10.3390/biom9080351

Figure Lengend Snippet: Integrative scheme. E6 oncoproteins from human papillomavirus type 16 (HPV16) and 18 (HPV18) decrease the levels of serine 473 phosphorylated-protein kinase B (pAkt), favoring the mitochondrial oxygen consumption and mitochondrial mass increase. E6 increases basal respiration (Routine), respiration leak and mitochondrial decoupling, while respiratory control index (RCI) significantly decreases, which could be associated to the increase in reactive oxygen species (ROS), oxidative stress (OS), and deoxyribonucleic acid (DNA) damage. Superoxide dismutase (SOD), catalase (CAT), glutathione (GSH), glutathione disulfide (GSSG), voltage-dependent anion channels (VDAC), superoxide anion (O 2 .− ), hydrogen peroxide (H 2 O 2 ), hydroxyl radical (OH .− ), nuclear factor (erythroid-derived 2)-like 2 (Nrf2) phosphorylated in serine 40 (pNrf2), forkhead box O3 (FoxO3a), gamma H2A histone family member X (γH2AX), and mitochondrial complexes I to V (CI, CII, CIII, CIV, CV).The yellow ray indicates damage to DNA.

Article Snippet: Primary antibodies were prepared in TBS/T buffer in the following concentrations: anti-glyceraldehyde 3 phosphate dehydrogenase (GAPDH) 1:1000 (SC-32233, Santa Cruz Biotechnology Inc., Dallas, TX, USA); anti-actinin 1:1000 (SC-17829, Santa Cruz Biotechnologies); anti-SOD2 1:1000 (#13141, Cell Signaling); anti-SOD1 1:1000 (#4266, Cell Signaling); anti-Akt 1:2000 (#2920, Cell Signaling); anti-phospho-Nrf2 Ser40 (pNrf2) 1:500 (ab76026, Abcam, Cambridge, UK); anti-phopho-Akt (Ser473) 1:2000 (#4060, Cell Signaling); anti-FoxO3a 1:1000 (#99199, Cell Signaling); Glutamate-cysteine ligase modifier subunit (GCLM) 1:500 (ab55436, Abcam); anti-catalase 1:500 (#12980, Cell Signaling); anti-gamma H2A histone family member X (γH2AX) 1:1000 (clone JBW301, Merck Millipore Upstade, Burlington, MA, USA); anti-FLAG M2 1:2000 (F1804, Sigma-Aldrich); anti-voltage dependent anion channel (VDAC) 1:1000 (sc-390996, Santa Cruz Biotechnologies); and, anti-total OXPHOS cocktail 1:1000 (ab110413, Abcam), which targets the following proteins: subunit of Complex I (NDUFB8-20 kD), subunit of Complex II (SDHB-30kD), subunit Complex III-Core protein 2 (UQCRC2-48 kD), subunit Complex IV subunit I (MTCO1-40 kD), and subunit Complex V alpha (ATP5A-55 kD).

Techniques: Control, Derivative Assay

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Migration, Flow Cytometry, Expressing, Control

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Inhibition